jagomart
digital resources
picture1_Market Ppt 66915 | Minion Tb Feb2020 Wgs Neil Stoker


 242x       Filetype PPTX       File size 2.79 MB       Source: media.tghn.org


File: Market Ppt 66915 | Minion Tb Feb2020 Wgs Neil Stoker
our mtb dna on the tapestation minion fastq file 2 records 576 bp 1316 bp illumina fastq file all records 100 bp there are 3 main approaches to sequencing market ...

icon picture PPTX Filetype Power Point PPTX | Posted on 28 Aug 2022 | 3 years ago
Partial capture of text on file.
  Our Mtb DNA on the Tapestation
     MinION fastq file
                2 records – 576 bp; 1316 bp
     Illumina fastq file
                   all records ~100 bp
               There are 3 main approaches to 
                                           sequencing
                           Market           Approach / USP       Read      Achievements    Ideal for:
                           dominance                             length
             st
            1  Generation  Applied          Sequencing by        1 kb      Most primary    PCR products 
            (Sanger)       Biosystems       synthesis (SBS)                drafts, e.g.    (genotyping)
                                            - Low throughput               Mtb, human
             nd
            2              Illumina         SBS                  100 bp    Cheap, rapid    WGS
            Generation     (IonTorrent)     - Massively parallel           resequencing 
                                            - Very high                    of millions of 
                                            throughput                     genomes
             rd
            3              Oxford           Single molecule      100 bp –  Sequencing in   Real-time 
            Generation     Nanopore         sequencing (SMS)     500 Mbp field / very      sequencing
                           (PacBio)                                        long lengths
           All genomes are ‘assembled’ by piecing together 
         small fragments into a consensus (‘shotgun sequencing’)
     GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
     GGCACCAGCCAGCTGAGCCAATTCATGGACCAGTACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 
     GGCACCAGCCAGCTGAGCCCATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 
     GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 
     GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG
     GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG 
     Consensus
      •  The first full assembly of any genome from scratch (de novo) and its annotation is hard
      •  It’s a hypothesis of a genome at a moment in time
      •  Overlapping sequences extends consensus, and improves evidence for each base call
      •  Errors occur for many reasons
The words contained in this file might help you see if this file matches what you are looking for:

...Our mtb dna on the tapestation minion fastq file records bp illumina all there are main approaches to sequencing market approach usp read achievements ideal for dominance length st generation applied by kb most primary pcr products sanger biosystems synthesis sbs drafts e g genotyping low throughput human nd cheap rapid wgs iontorrent massively parallel resequencing very high of millions genomes rd oxford single molecule in real time nanopore sms mbp field pacbio long lengths assembled piecing together small fragments into a consensus shotgun ggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg ggcaccagccagctgagccaattcatggaccagtacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg ggcaccagccagctgagcccattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg first full assembly any genome from scratch de novo and its annotation is hard it s hypothesis at moment overlapping sequences extends improves evidence each base call errors occur many reasons...

no reviews yet
Please Login to review.